| Detail of EST/Unigene BG449139 |
| Acc. | BG449139 |
| Internal Acc. | NF033C09IN1F1068 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) E-value=2e-36; Carbamoyl-phosphate synthase small chain OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=3e-36; Carbamoyl-phosphate synthase small chain OS=Vibrio vulnificus (strain YJ016) E-value=1e-35; Carbamoyl-phosphate synthase small chain OS=Vibrio vulnificus (strain CMCP6) E-value=1e-35; Carbamoyl-phosphate synthase small chain OS=Teredinibacter turnerae (strain ATCC 39867 / T7901) E-value=1e-35; |
| Length | 671 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | GTTTGGTTTTTTTTTCTCANACATATCTCTGTGTAACCGTTGTTCTCAGCCTTCATTGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822396 |
| Trichome-related Gene from Literature | N/A |