Detail of EST/Unigene BG449363 |
Acc. | BG449363 |
Internal Acc. | NF046G12IN1F1098 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Tricyclene synthase TPS4, chloroplastic OS=Medicago truncatula E-value=1e-67; Tricyclene synthase EBOS, chloroplastic OS=Lotus japonicus E-value=3e-35; Isoprene synthase, chloroplastic OS=Populus canescens E-value=1e-15; Isoprene synthase, chloroplastic OS=Populus alba E-value=2e-15; (+)-alpha-pinene synthase, chloroplastic OS=Cannabis sativa E-value=4e-15; |
Length | 450 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CTTCCTTATTCTCTCACTTGCAAAGAACTCTTCCTTTATATCACAAGTATCCCTATACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827377 |
Trichome-related Gene from Literature | N/A |