Detail of EST/Unigene BG449759 |
Acc. | BG449759 |
Internal Acc. | NF007F08IN1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable plastid-lipid-associated protein 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-57; Probable plastid-lipid-associated protein 5, chloroplastic OS=Arabidopsis thaliana E-value=9e-54; Probable plastid-lipid-associated protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-09; Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=6e-08; Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=2e-07; |
Length | 634 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | CAAATCATTCACATCAAAAACTACTCCATTCACCAATACCTTCTTCTTATTCTTCTTCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822204 |
Trichome-related Gene from Literature | N/A |