Detail of EST/Unigene BG449765 |
Acc. | BG449765 |
Internal Acc. | NF007G05IN1F1037 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-81; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=8e-51; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=1e-50; Carbonic anhydrase OS=Flaveria brownii E-value=5e-49; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GTGATTTGAGTCTTCATTGTCACAATGTCTACCTCTTCCATAAACGGCTTTAGTCTCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |