| Detail of EST/Unigene BG449787 |
| Acc. | BG449787 |
| Internal Acc. | NF053A01IN1F1001 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Choline monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=2e-61; Choline monooxygenase, chloroplastic OS=Atriplex hortensis E-value=9e-58; Choline monooxygenase, chloroplastic OS=Spinacia oleracea E-value=3e-54; Choline monooxygenase, chloroplastic OS=Amaranthus tricolor E-value=2e-53; Choline monooxygenase, chloroplastic OS=Beta vulgaris E-value=5e-52; |
| Length | 663 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TGAACATGCAAGTAACACCTTTCAATATCCCAAACCTCCAAAAGAGACAGCCTCAGAACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829111 |
| Trichome-related Gene from Literature | N/A |