| Detail of EST/Unigene BG449963 |
| Acc. | BG449963 |
| Internal Acc. | NF012B03DT1F1029 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase family 2 member B7, mitochondrial OS=Arabidopsis thaliana E-value=6e-38; Aldehyde dehydrogenase family 2 member B4, mitochondrial OS=Arabidopsis thaliana E-value=1e-36; Retinal dehydrogenase 1 OS=Oryctolagus cuniculus E-value=3e-22; Retinal dehydrogenase 1 OS=Gallus gallus E-value=6e-22; Retinal dehydrogenase 1 OS=Macaca fascicularis E-value=6e-22; |
| Length | 538 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | AGTGGANAAAAAGATAGGTTTATTGAACAAATTACAAGCCAGCAACACAACATCTACTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
| EC | 1.2.1.3 1.2.1.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838991 |
| Trichome-related Gene from Literature | N/A |