| Detail of EST/Unigene BG449990 |
| Acc. | BG449990 |
| Internal Acc. | NF012F07DT1F1063 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=0; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=0; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=0; GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=4e-98; UDP-glucuronic acid decarboxylase 1 OS=Danio rerio E-value=5e-12; |
| Length | 634 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CAAAGATTTCGGAATTGAGTGCCGCATTGGGAGGTTCCATAACATATATGGTCCTTTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K08678 UDP-glucuronate decarboxylase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K08678 UDP-glucuronate decarboxylase |
| EC | 4.1.1.35 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833002 |
| Trichome-related Gene from Literature | N/A |