| Detail of EST/Unigene BG450138 |
| Acc. | BG450138 |
| Internal Acc. | NF015B07DT1F1061 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=1e-74; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=8e-73; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=1e-70; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=5e-70; Aldose reductase OS=Hordeum vulgare E-value=2e-41; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CAGACATACCAAGCACATGGAAAGCATTGGAAGCACTATATGACTCTGGCAAGGCTAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.2 1.1.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818354 |
| Trichome-related Gene from Literature | N/A |