Detail of EST/Unigene BG450247 |
Acc. | BG450247 |
Internal Acc. | NF012E03DT1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent glyceraldehyde-3-phosphate dehydrogenase OS=Pisum sativum E-value=3e-95; NADP-dependent glyceraldehyde-3-phosphate dehydrogenase OS=Triticum aestivum E-value=1e-94; NADP-dependent glyceraldehyde-3-phosphate dehydrogenase OS=Nicotiana plumbaginifolia E-value=3e-94; NADP-dependent glyceraldehyde-3-phosphate dehydrogenase OS=Zea mays E-value=3e-94; NADP-dependent glyceraldehyde-3-phosphate dehydrogenase OS=Apium graveolens E-value=3e-93; |
Length | 612 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTGAACTGCATAAGTTTCACTGGTGGAGACACTGGAATAGCAATATCAAAGAAGTCTGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00129 aldehyde dehydrogenase (NAD(P)+); Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07249 retinal dehydrogenase |
EC | 1.2.1.36 1.2.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816962 |
Trichome-related Gene from Literature | N/A |