| Detail of EST/Unigene BG450318 |
| Acc. | BG450318 |
| Internal Acc. | NF031C07DT1F1054 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Keratin, high-sulfur matrix protein, B2D OS=Ovis aries E-value=7e-08; Keratin-associated protein 4-9 OS=Homo sapiens E-value=2e-06; Keratin, high-sulfur matrix protein, B2A OS=Ovis aries E-value=4e-06; Keratin-associated protein 4-12 OS=Homo sapiens E-value=6e-06; Keratin-associated protein 4-6 OS=Homo sapiens E-value=8e-06; |
| Length | 599 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GTCACTAACATGGCTTCCTCAAACTTCCTAGTGCTGCTTCTTTTTGCTCTATTTGCCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.3.1.48 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |