Detail of EST/Unigene BG450318 |
Acc. | BG450318 |
Internal Acc. | NF031C07DT1F1054 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Keratin, high-sulfur matrix protein, B2D OS=Ovis aries E-value=7e-08; Keratin-associated protein 4-9 OS=Homo sapiens E-value=2e-06; Keratin, high-sulfur matrix protein, B2A OS=Ovis aries E-value=4e-06; Keratin-associated protein 4-12 OS=Homo sapiens E-value=6e-06; Keratin-associated protein 4-6 OS=Homo sapiens E-value=8e-06; |
Length | 599 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTCACTAACATGGCTTCCTCAAACTTCCTAGTGCTGCTTCTTTTTGCTCTATTTGCCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.3.1.48 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |