Detail of EST/Unigene BG450410 |
Acc. | BG450410 |
Internal Acc. | NF014E02DT1F1019 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Spermidine synthase 1 OS=Pisum sativum E-value=9e-73; Spermidine synthase OS=Solanum lycopersicum E-value=4e-63; Spermidine synthase 2 OS=Pisum sativum E-value=7e-63; Spermidine synthase 2 OS=Arabidopsis thaliana E-value=8e-61; Spermidine synthase 1 OS=Arabidopsis thaliana E-value=2e-60; |
Length | 569 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CACGAATCAAGTGACTTCCCTACTTCATTGCAAACCAAACCAAAACAAACATGGCGGCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843367 |
Trichome-related Gene from Literature | N/A |