| Detail of EST/Unigene BG450827 |
| Acc. | BG450827 |
| Internal Acc. | NF093E03DT1F1021 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=4e-32; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-16; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=7e-16; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=4e-15; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=3e-13; |
| Length | 606 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GCTTCTCCTTTTCTTTCTCTCCTTTTCCCATTTCTTTCGATATCTCTCTCTCATTTTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820440 |
| Trichome-related Gene from Literature | N/A |