Detail of EST/Unigene BG450902 |
Acc. | BG450902 |
Internal Acc. | NF095A10DT1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-76; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-64; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=7e-58; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-42; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-42; |
Length | 699 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAATCTCTTCCTTCTGCTTCAGAGTGATAATGCTGTTTCTCACCTTTTCAGATTTGTTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817295 |
Trichome-related Gene from Literature | N/A |