Detail of EST/Unigene BG450924 |
Acc. | BG450924 |
Internal Acc. | NF096G01DT1F1006 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable acetyl-CoA acetyltransferase, cytosolic 2 OS=Arabidopsis thaliana E-value=1e-40; Acetyl-CoA acetyltransferase, cytosolic 1 OS=Arabidopsis thaliana E-value=6e-40; Acetyl-CoA acetyltransferase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-18; Acetyl-CoA acetyltransferase OS=Saccharomyces bayanus E-value=2e-18; Acetyl-CoA acetyltransferase IA OS=Candida tropicalis E-value=8e-18; |
Length | 490 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTCTATAATGACTTTGGCATGGGAGTTTGTGCAGAAATGTGTGCAGATCAGCATGCCATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834823 |
Trichome-related Gene from Literature | N/A |