| Detail of EST/Unigene BG450929 |
| Acc. | BG450929 |
| Internal Acc. | NF096G09DT1F1070 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative steroid dehydrogenase let-767 OS=Caenorhabditis briggsae E-value=1e-15; Putative steroid dehydrogenase 4 OS=Caenorhabditis elegans E-value=2e-14; Putative steroid dehydrogenase let-767 OS=Caenorhabditis elegans E-value=2e-14; Putative steroid dehydrogenase 1 OS=Caenorhabditis elegans E-value=3e-13; Estradiol 17-beta-dehydrogenase 12 OS=Anas platyrhynchos E-value=7e-13; |
| Length | 669 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GCCCTCTTAAGCTTGAGGCAACATCAAAAGAGATTATAGATAAAACTTTTGGAAATGTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
| EC | 1.1.1.- 1.1.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843098 |
| Trichome-related Gene from Literature | N/A |