Detail of EST/Unigene BG451057 |
Acc. | BG451057 |
Internal Acc. | NF097F11DT1F1093 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heme oxygenase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-58; Heme oxygenase 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-55; Heme oxygenase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-50; Heme oxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-42; Probable inactive heme oxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-30; |
Length | 682 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAACAATTCTTATTCTTCCAAACCAAAGCAATCCAATCCATGGCGTCACCTAACACCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817208 |
Trichome-related Gene from Literature | N/A |