Detail of EST/Unigene BG451377 |
Acc. | BG451377 |
Internal Acc. | NF107G04DT1F1034 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=4e-18; Furcatin hydrolase OS=Viburnum furcatum E-value=1e-16; Beta-glucosidase 29 OS=Oryza sativa subsp. japonica E-value=4e-16; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=6e-16; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=8e-16; |
Length | 618 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | AAACAATACAGTTGTCATTTTTCTATCAACTTCCAAAGTTTTCTTAGATGGAGAAAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819052 |
Trichome-related Gene from Literature | N/A |