Detail of EST/Unigene BG451383 |
Acc. | BG451383 |
Internal Acc. | NF107H04DT1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=3e-99; Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=2e-97; Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=6e-97; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=4e-92; Translation factor GUF1 homolog, chloroplastic OS=Physcomitrella patens subsp. patens E-value=3e-88; |
Length | 665 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GGTGATACTGTTGAATGCTCAAATCCATCTTTGCTTCCTGAGCCTGGTATAAGAAGATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830766 |
Trichome-related Gene from Literature | N/A |