| Detail of EST/Unigene BG451391 |
| Acc. | BG451391 |
| Internal Acc. | NF107A05DT1F1035 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=3e-53; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=4e-48; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=1e-46; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-45; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=1e-34; |
| Length | 671 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | AACAAACTCTTTAATGTTCATGTCTGTTATTACTTCTTCATCACAACAAACTCATCAATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.1.52 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838410 |
| Trichome-related Gene from Literature | N/A |