Detail of EST/Unigene BG451391 |
Acc. | BG451391 |
Internal Acc. | NF107A05DT1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=3e-53; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=4e-48; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=1e-46; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-45; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=1e-34; |
Length | 671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | AACAAACTCTTTAATGTTCATGTCTGTTATTACTTCTTCATCACAACAAACTCATCAATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838410 |
Trichome-related Gene from Literature | N/A |