Detail of EST/Unigene BG451615 |
Acc. | BG451615 |
Internal Acc. | NF092H07DT1F1061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 7 OS=Arabidopsis thaliana E-value=5e-61; 4-coumarate--CoA ligase-like 1 OS=Oryza sativa subsp. japonica E-value=7e-47; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=2e-30; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=2e-30; 4-coumarate--CoA ligase-like 9 OS=Arabidopsis thaliana E-value=1e-29; |
Length | 578 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | TTTCAATTTCAACTTTCCAGCAATTATCATTAATTCGGGTAATGCAACGGGTTCATATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825864 |
Trichome-related Gene from Literature | N/A |