Detail of EST/Unigene BG451770 |
Acc. | BG451770 |
Internal Acc. | NF100C01DT1F1002 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-isopropylmalate dehydratase OS=Arabidopsis thaliana E-value=0; Isopropylmalate/citramalate isomerase large subunit OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=2e-47; 3-isopropylmalate dehydratase large subunit 1 OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) E-value=2e-45; 3-isopropylmalate dehydratase large subunit 1 OS=Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938) E-value=4e-42; 3-isopropylmalate dehydratase large subunit 2 OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) E-value=3e-40; |
Length | 655 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTTACACCTGGGGATAATATTTGGGTTGATGTTGATGTTTTGATGACTCATGATGTTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
EC | 4.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826975 |
Trichome-related Gene from Literature | N/A |