Detail of EST/Unigene BG451837 |
Acc. | BG451837 |
Internal Acc. | NF101B02DT1F1013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=2e-82; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=7e-71; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=1e-69; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=2e-69; Probable beta-1,3-galactosyltransferase 16 OS=Arabidopsis thaliana E-value=1e-41; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTCATACATTTTGTCATCATGGTGATTTTCTCCAAATACTAACTATCTAAGATAATCACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827853 |
Trichome-related Gene from Literature | N/A |