| Detail of EST/Unigene BG451837 |
| Acc. | BG451837 |
| Internal Acc. | NF101B02DT1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=2e-82; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=7e-71; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=1e-69; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=2e-69; Probable beta-1,3-galactosyltransferase 16 OS=Arabidopsis thaliana E-value=1e-41; |
| Length | 663 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GTCATACATTTTGTCATCATGGTGATTTTCTCCAAATACTAACTATCTAAGATAATCACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.4.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827853 |
| Trichome-related Gene from Literature | N/A |