| Detail of EST/Unigene BG452020 |
| Acc. | BG452020 |
| Internal Acc. | NF083F07LF1F1063 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=1e-35; Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=2e-23; Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=2e-19; Polyphosphatidylinositol phosphatase INP53 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=5e-06; |
| Length | 498 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | AGGAAAGGTCACAGAACAATCAACAGCTTTTTTGGGCAAGAGTGGTGATGCGTAAATGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.1.3.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840311 |
| Trichome-related Gene from Literature | N/A |