Detail of EST/Unigene BG452206 |
Acc. | BG452206 |
Internal Acc. | NF077H10LF1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-78; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=8e-51; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=4e-46; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-45; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-42; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CACAAACGTGTTGCCTTATTACCCTGCCAGTAACATCACTCTCATCACCGTCGGTAACGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816120 |
Trichome-related Gene from Literature | N/A |