| Detail of EST/Unigene BG452206 |
| Acc. | BG452206 |
| Internal Acc. | NF077H10LF1F1092 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=3e-78; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=8e-51; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=4e-46; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-45; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-42; |
| Length | 679 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CACAAACGTGTTGCCTTATTACCCTGCCAGTAACATCACTCTCATCACCGTCGGTAACGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816120 |
| Trichome-related Gene from Literature | N/A |