| Detail of EST/Unigene BG452292 |
| Acc. | BG452292 |
| Internal Acc. | NF083D11LF1F1094 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-20; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-20; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=8e-20; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-19; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-19; |
| Length | 620 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CAGAAACATTGAACAACGTTAAGAAGAACCTCATTGTCTTTAACTTACCTTGGTCTCTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818107 |
| Trichome-related Gene from Literature | N/A |