Detail of EST/Unigene BG452351 |
Acc. | BG452351 |
Internal Acc. | NF092F11LF1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=3e-30; Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=6e-18; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=3e-15; |
Length | 647 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GGAAGACATCCATCTGAGGATCTTGATATTGATGACTGGATTTATGCCGAAGAACCAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827526 |
Trichome-related Gene from Literature | N/A |