| Detail of EST/Unigene BG452654 |
| Acc. | BG452654 |
| Internal Acc. | NF079B11LF1F1090 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetylornithine aminotransferase, mitochondrial OS=Alnus glutinosa E-value=3e-60; Acetylornithine aminotransferase, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=7e-60; Acetylornithine aminotransferase OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) E-value=4e-32; Acetylornithine aminotransferase OS=Haemophilus ducreyi (strain 35000HP / ATCC 700724) E-value=4e-31; Acetylornithine aminotransferase OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=3e-30; |
| Length | 656 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CACAACAATGTCGACCCACCACATTTATGCTAACAGCACAACATACCAATCTTCATCATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00819 ornithine--oxo-acid transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00827 alanine--glyoxylate transaminase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00827 alanine--glyoxylate transaminase |
| EC | 2.6.1.13 2.6.1.40 2.6.1.44 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844399 |
| Trichome-related Gene from Literature | N/A |