Detail of EST/Unigene BG452655 |
Acc. | BG452655 |
Internal Acc. | NF078C10LF1F1071 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=2e-73; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=8e-70; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-68; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=4e-67; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=2e-65; |
Length | 670 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | TATATGCCGACATGTCAGTAACTTGTAAGGAATACTATAACCCAAACCAGTCTATGTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |