| Detail of EST/Unigene BG452909 |
| Acc. | BG452909 |
| Internal Acc. | NF087A07LF1F1050 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=5e-28; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=7e-28; Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-27; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-27; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=6e-27; |
| Length | 452 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CATTTGACGGCATTAAGGAGAAGTCAGTGTTCTTCTTTAAAGGCTTCTATGGGATCTCCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 4.2.-.- 4.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.5 Zn2+-Fe2+ transporter (aka permease) ZIP; 2.A.53 Sulfate porter (aka permease) SulP |
| Probeset |
|
| Corresponding NCBI Gene | 829498 |
| Trichome-related Gene from Literature | N/A |