| Detail of EST/Unigene BG452910 |
| Acc. | BG452910 |
| Internal Acc. | NF086C05LF1F1035 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=0; 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=0; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=0; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=0; |
| Length | 677 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | TTCTTCTCGCCGTAGTAGCTTTCTTGTTAAAGCCTCTAGTGAGCTTCCATTGGTTGGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.11.1.15 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820335 |
| Trichome-related Gene from Literature | N/A |