Detail of EST/Unigene BG452960 |
Acc. | BG452960 |
Internal Acc. | NF087C09LF1F1067 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-15; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-15; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-12; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; |
Length | 569 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CAACCTTGTCCCACTTTGCTTGTGGATAAAGCGTTTTTATGAGAACCCTTTTTCTGCACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837379 |
Trichome-related Gene from Literature | N/A |