| Detail of EST/Unigene BG452960 |
| Acc. | BG452960 |
| Internal Acc. | NF087C09LF1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-16; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-15; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-15; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-12; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; |
| Length | 569 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CAACCTTGTCCCACTTTGCTTGTGGATAAAGCGTTTTTATGAGAACCCTTTTTCTGCACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837379 |
| Trichome-related Gene from Literature | N/A |