Detail of EST/Unigene BG453008 |
Acc. | BG453008 |
Internal Acc. | NF088A07LF1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-36; Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-34; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=6e-33; Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=8e-31; Leucine aminopeptidase, chloroplastic OS=Solanum tuberosum E-value=1e-30; |
Length | 530 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GTAAAAGAAGTTTTGGAAGCTTCTGAAGTGAGTGGGGAGAAACTATGGCGGCTGCCAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.11.1 3.4.11.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816954 |
Trichome-related Gene from Literature | N/A |