| Detail of EST/Unigene BG453071 |
| Acc. | BG453071 |
| Internal Acc. | NF090B05LF1F1042 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-isopropylmalate dehydratase OS=Arabidopsis thaliana E-value=0; 3-isopropylmalate dehydratase large subunit 1 OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) E-value=6e-48; 3-isopropylmalate dehydratase large subunit 1 OS=Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938) E-value=7e-47; Isopropylmalate/citramalate isomerase large subunit OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=3e-46; 3-isopropylmalate dehydratase large subunit OS=Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562) E-value=4e-46; |
| Length | 646 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCAGATTACAAAGGTGTTTGTCACATTGCTCTTGCTCAGGAAGGTCATTGCAGGCCAGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
| EC | 4.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826975 |
| Trichome-related Gene from Literature | N/A |