Detail of EST/Unigene BG453159 |
Acc. | BG453159 |
Internal Acc. | NF086F11LF1F1092 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-19; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=6e-19; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-18; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-18; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=4e-18; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GTACGAGGACCACTACCATCACAACAACATGGCCACTGCAGCAGGCATGGCCTCATTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 5.2.1.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |