| Detail of EST/Unigene BG453175 |
| Acc. | BG453175 |
| Internal Acc. | NF091H06LF1F1057 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable acetyl-CoA acetyltransferase, cytosolic 2 OS=Arabidopsis thaliana E-value=3e-16; Acetyl-CoA acetyltransferase, cytosolic 1 OS=Arabidopsis thaliana E-value=1e-14; Acetyl-CoA acetyltransferase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-12; Acetyl-CoA acetyltransferase IB OS=Candida tropicalis E-value=1e-09; Acetyl-CoA acetyltransferase IA OS=Candida tropicalis E-value=1e-09; |
| Length | 554 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | AGTTAAGGAAATTCCTAGACCTCAGAATATTCCCATTAATTATTTTCCATGAATACGAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834823 |
| Trichome-related Gene from Literature | N/A |