Detail of EST/Unigene BG453288 |
Acc. | BG453288 |
Internal Acc. | NF088D06LF1F1047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=1e-50; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=4e-32; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=6e-30; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-30; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=3e-29; |
Length | 524 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | ATTTACTTGGTGGAATTCTAAATATCATTGTGCTAATCTTTTCCATATTTTTCATATGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |