Detail of EST/Unigene BG453337 |
Acc. | BG453337 |
Internal Acc. | NF090B12LF1F1094 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 2 OS=Homo sapiens E-value=6e-45; Replication factor C subunit 2 OS=Rattus norvegicus E-value=8e-45; Replication factor C subunit 2 OS=Mus musculus E-value=8e-45; Replication factor C subunit 2 OS=Gallus gallus E-value=2e-43; Replication factor C subunit 2 OS=Bos taurus E-value=3e-43; |
Length | 622 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GAACCAAGCTAAACATAACATATTTATATAAGTTGAAGCATTAATGTATCAGTCAACATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842620 |
Trichome-related Gene from Literature | N/A |