| Detail of EST/Unigene BG453384 |
| Acc. | BG453384 |
| Internal Acc. | NF093B10LF1F1078 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain LESB58) E-value=1e-66; Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=2e-66; Argininosuccinate lyase OS=Pseudomonas aeruginosa (strain UCBPP-PA14) E-value=2e-66; Argininosuccinate lyase OS=Pseudomonas putida (strain W619) E-value=2e-66; Argininosuccinate lyase OS=Pseudomonas putida (strain GB-1) E-value=4e-66; |
| Length | 665 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | CCGACGCCGTCGAACGATTCACTGAATCCGTCTCTTATGATAAACAGTTATACAAACATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01755 argininosuccinate lyase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01755 argininosuccinate lyase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01755 argininosuccinate lyase |
| EC | 4.3.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830959 |
| Trichome-related Gene from Literature | N/A |