| Detail of EST/Unigene BG453845 |
| Acc. | BG453845 |
| Internal Acc. | NF102A05LF1F1034 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Secologanin synthase OS=Catharanthus roseus E-value=6e-46; Cytochrome P450 72C1 OS=Arabidopsis thaliana E-value=1e-39; Cytochrome P450 734A1 OS=Arabidopsis thaliana E-value=2e-32; Cytochrome P450 734A6 OS=Oryza sativa subsp. japonica E-value=4e-27; Cytochrome P450 734A5 OS=Oryza sativa subsp. japonica E-value=4e-27; |
| Length | 660 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | AAACAATGGAAAACTTAGGAACATTATTATCATCATTAAATTTGCAGCCAACAAAAGTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00490 cytochrome P450, family 4, subfamily F (leukotriene-B4 20-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07424 cytochrome P450, family 3, subfamily A |
| EC | 1.14.13.30 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820697 |
| Trichome-related Gene from Literature | N/A |