Detail of EST/Unigene BG453849 |
Acc. | BG453849 |
Internal Acc. | NF101E11LF1F1084 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Spermine synthase OS=Arabidopsis thaliana E-value=1e-62; Spermidine synthase 1 OS=Arabidopsis thaliana E-value=9e-36; Spermidine synthase OS=Solanum lycopersicum E-value=1e-34; Spermidine synthase 2 OS=Datura stramonium E-value=2e-34; Spermidine synthase OS=Coffea arabica E-value=2e-34; |
Length | 565 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | GTGAGAGAGAGAGAGAGAGAGTCGTTGCGTTTGTATCAACAACACTCTCACCGATATTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835392 |
Trichome-related Gene from Literature | N/A |