| Detail of EST/Unigene BG454166 |
| Acc. | BG454166 |
| Internal Acc. | NF097E06LF1F1040 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-32; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=4e-32; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-32; Oxygen-evolving enhancer protein 3, chloroplastic OS=Onobrychis viciifolia E-value=4e-31; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=3e-29; |
| Length | 381 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | AGCAAATTTTTTTCTCATTTGATTTTCTTCAAATAGAAGTTAAACATAAAGTGTCTTAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825866 |
| Trichome-related Gene from Literature | N/A |