| Detail of EST/Unigene BG454584 |
| Acc. | BG454584 |
| Internal Acc. | NF102B03LF1F1026 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 3, chloroplastic OS=Spinacia oleracea E-value=9e-42; 30S ribosomal protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-38; 30S ribosomal protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-36; 30S ribosomal protein 3, chloroplastic OS=Hordeum vulgare E-value=1e-34; Probable 30S ribosomal protein 3, chloroplastic OS=Mesostigma viride E-value=4e-21; |
| Length | 669 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF; |
| Sequence | ATTCGACAGAATCGAATCCAACAACAATGAACATGTTAGCATCATCATCATCAACAACAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843189 |
| Trichome-related Gene from Literature | N/A |