Detail of EST/Unigene BG454723 |
Acc. | BG454723 |
Internal Acc. | NF105D06LF1F1047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=1e-37; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=5e-34; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=8e-33; Cytochrome P450 71B38 OS=Arabidopsis thaliana E-value=2e-27; Cytochrome P450 71B21 OS=Arabidopsis thaliana E-value=2e-27; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF; |
Sequence | CTATATCAAAATGGAAGAATCAACTAGGTGGATGATACACACTTCACTTTTTCTCTTCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833619 |
Trichome-related Gene from Literature | N/A |