| Detail of EST/Unigene BG455285 |
| Acc. | BG455285 |
| Internal Acc. | NF046E07PL1F1053 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=3e-14; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; Protochlorophyllide reductase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-13; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=5e-13; Protochlorophyllide reductase, chloroplastic OS=Marchantia paleacea E-value=7e-13; |
| Length | 108 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | TTAACAGTTCCGCCATGATAGATGGTGGAGATTTTGATGGTGCCAAGGCATACAAGGACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828853 |
| Trichome-related Gene from Literature | N/A |