Detail of EST/Unigene BG455311 |
Acc. | BG455311 |
Internal Acc. | NF046H09PL1F1078 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplastic OS=Brassica napus E-value=5e-34; 1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=8e-33; 1-acyl-sn-glycerol-3-phosphate acyltransferase OS=Cocos nucifera E-value=3e-07; 1-acyl-sn-glycerol-3-phosphate acyltransferase OS=Limnanthes douglasii E-value=2e-06; Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=6e-06; |
Length | 594 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | CAAGAAAGGAGCCTCTGTCTTTTTCTTCCCGGAGGGAACACGCACTAAAGATGGAAAATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase |
EC | 2.3.1.51 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829181 |
Trichome-related Gene from Literature | N/A |