| Detail of EST/Unigene BG455333 |
| Acc. | BG455333 |
| Internal Acc. | NF047B02PL1F1015 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-12; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=2e-11; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=9e-07; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-06; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-06; |
| Length | 175 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | ATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGCTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |