| Detail of EST/Unigene BG455424 |
| Acc. | BG455424 |
| Internal Acc. | NF056A09PL1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=8e-27; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-26; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-25; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-25; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=1e-24; |
| Length | 307 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | NTTATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCCATGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |