Detail of EST/Unigene BG455525 |
Acc. | BG455525 |
Internal Acc. | NF061G05PL1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=2e-59; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=1e-58; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=1e-57; 30S ribosomal protein S8, chloroplastic OS=Vitis vinifera E-value=4e-56; 30S ribosomal protein S8, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=8e-56; |
Length | 666 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF; |
Sequence | AAACAGGAGCACGTTTATTATATCGAAAGTAAGGAGCAATAATCTATCGTGGGTAAAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |