| Detail of EST/Unigene BG455525 |
| Acc. | BG455525 |
| Internal Acc. | NF061G05PL1F1038 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=2e-59; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=1e-58; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=1e-57; 30S ribosomal protein S8, chloroplastic OS=Vitis vinifera E-value=4e-56; 30S ribosomal protein S8, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=8e-56; |
| Length | 666 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | AAACAGGAGCACGTTTATTATATCGAAAGTAAGGAGCAATAATCTATCGTGGGTAAAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |