| Detail of EST/Unigene BG455527 |
| Acc. | BG455527 |
| Internal Acc. | NF059A03PL1F1019 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S14, chloroplastic OS=Arabidopsis thaliana E-value=6e-16; 30S ribosomal protein S14, chloroplastic OS=Lotus japonicus E-value=8e-16; 30S ribosomal protein S14, chloroplastic OS=Phaseolus vulgaris E-value=1e-15; 30S ribosomal protein S14, chloroplastic OS=Pisum sativum E-value=2e-15; 30S ribosomal protein S14, chloroplastic OS=Glycine max E-value=3e-15; |
| Length | 140 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | CGTTAAGTGAGAAATGGGAAATTCAGGGAAAGTTAGAAGCACTACCGCGTAATAGTGCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |