| Detail of EST/Unigene BG455545 |
| Acc. | BG455545 |
| Internal Acc. | NF065C06PL1F1040 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=6e-57; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=3e-49; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=3e-44; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=2e-22; Photosystem I reaction center subunit V (Fragment) OS=Pisum sativum E-value=2e-14; |
| Length | 600 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF; |
| Sequence | GGCAGCTTCAGCCTCATCCATGATATCAACTCATGCATTAACAACCACCATTCAAAAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842016 |
| Trichome-related Gene from Literature | N/A |